circad | circRNAs associated with diseases

Circ-ZNF609
Gene	ZNF609	Organism	Human
Genome Locus	chr15:64791491-64792365:+	Build	hg19
Disease	Colorectal Cancer	ICD-10	Malignant neoplasm of rectosigmoid junction (C19)
DBLink	Link to database	PMID	30570857
Experimental Method
Sample Type	Tissues	Comparison	Twenty-four paraffin-embedded specimens of colorectal cancer tissues and 36 normal mucosa tissues 5 cm away from the tumor edge
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CAGCGCTCAATCCTTTGGGA Reverse GACCTGCCACATTGGTCAGTA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Wu, L, Xia, J, Yang, J, Shi, Y, Xia, H, Xiang, X, Yu, X (2018). Circ-ZNF609 promotes migration of colorectal cancer by inhibiting Gli1 expression via microRNA-150. J BUON, 23, 5:1343-1349.